Background There have been no effective treatments for slowing or reversing Alzheimer’s disease(AD)until now.Growing preclinical evidence,including this study,suggests that mesenchymal stem cells-secreted exosomes(MS...Background There have been no effective treatments for slowing or reversing Alzheimer’s disease(AD)until now.Growing preclinical evidence,including this study,suggests that mesenchymal stem cells-secreted exosomes(MSCs-Exos)have the potential to cure AD.Aims The first three-arm,drug-intervention,phase I/II clinical trial was conducted to explore the safety and efficacy of allogenic human adipose MSCs-Exos(ahaMSCs-Exos)in patients with mild to moderate AD.Methods The eligible subjects were assigned to one of three dosage groups,intranasally administrated with ahaMSCs-Exos two times per week for 12 weeks,and underwent follow-up visits at weeks 16,24,36 and 48.Results No adverse events were reported.In the medium-dose arm,Alzheimer’s Disease Assessment Scale–Cognitive section(ADAS-cog)scores decreased by 2.33(1.19)and the basic version of Montreal Cognitive Assessment scores increased by 2.38(0.58)at week 12 compared with baseline levels,indicating improved cognitive function.Moreover,the ADAS-cog scores in the medium-dose arm decreased continuously by 3.98 points until week 36.There were no significant differences in altered amyloid or tau deposition among the three arms,but hippocampal volume shrank less in the medium-dose arm to some extent.Conclusions Intranasal administration of ahaMSCs-Exos was safe and well tolerated,and a dose of at least 4×10^(8)particles could be selected for further clinical trials.展开更多
Parkinson’s disease (PD) is one of the commonest neurodegenerative disorders characterized by the loss of dopaminergic (DAergic) neurons in the substantia nigra and the appearance of Lewy bodies (LBs), whose cytoplas...Parkinson’s disease (PD) is one of the commonest neurodegenerative disorders characterized by the loss of dopaminergic (DAergic) neurons in the substantia nigra and the appearance of Lewy bodies (LBs), whose cytoplasmic inclusions are highly enriched with ubiquitin, synphilin-1, α-synuclein and parkin. Synphilin-1 is an α-synuclein-binding protein and a major component of LBs. It is widely accepted that synphilin-1 is involved in the pathogenic process of PD. This review will provide an overall view of the role of synphilin-1 in the pathogenesis of Parkinson’s disease and the latest findings in this field.展开更多
Parkinson’s disease (PD) is a slowly progressive neurodegenerative disorder characterized clinically by bradykinesia, rigidity, tremor, gait dysfunction, and postural instability. Several genes have been identified f...Parkinson’s disease (PD) is a slowly progressive neurodegenerative disorder characterized clinically by bradykinesia, rigidity, tremor, gait dysfunction, and postural instability. Several genes have been identified for monogenic disorders that variably resemble Parkinson’s disease. Here, we focus on PARK7, a gene relates to an autosomal recessive form of early-onset Parkinsonism and encodes a protein named DJ-1. Though the exact role of DJ-1 needs to be elucidated, it is generally thought to be functioned as a molecular chaperone and an oxidative sensor (or antioxidative factor). We will review the protective role of DJ-1 to prevent dopaminergic neurons in the substantia nigra pars compacta (SNpc) from degeneration and how its dysfunction would lead to neurodegeneration.展开更多
Adult polyglucosan body disease(APBD)is a rare and highly heterogeneous glycogen storage disorder due to biallelic variants in GBE1.1 Typical APBD presentations include gait abnormalities with polyneuropathy,leukodyst...Adult polyglucosan body disease(APBD)is a rare and highly heterogeneous glycogen storage disorder due to biallelic variants in GBE1.1 Typical APBD presentations include gait abnormalities with polyneuropathy,leukodystrophy,neurogenic bladder,and mild cognitive impairment.Differential diagnosis of APBD encompasses a large spectrum of conditions including axonal and demyelinating sensorimotor polyneuropathy,progressive spastic paraparesis,and leukodystrophies.展开更多
Alzheimer's disease is a progressive neurological disorder characterized by cognitive decline and chronic inflammation within the brain.The ketogenic diet,a widely recognized therapeutic intervention for refractor...Alzheimer's disease is a progressive neurological disorder characterized by cognitive decline and chronic inflammation within the brain.The ketogenic diet,a widely recognized therapeutic intervention for refractory epilepsy,has recently been proposed as a potential treatment for a variety of neurological diseases,including Alzheimer's disease.However,the efficacy of ketogenic diet in treating Alzheimer's disease and the underlying mechanism remains unclear.The current investigation aimed to explore the effect of ketogenic diet on cognitive function and the underlying biological mechanisms in a mouse model of Alzheimer's disease.Male amyloid precursor protein/presenilin 1(APP/PS1)mice were randomly assigned to either a ketogenic diet or control diet group,and received their respective diets for a duration of 3 months.The findings show that ketogenic diet administration enhanced cognitive function,attenuated amyloid plaque formation and proinflammatory cytokine levels in APP/PS1 mice,and augmented the nuclear factor-erythroid 2-p45 derived factor 2/heme oxygenase-1 signaling pathway while suppressing the nuclear factor-kappa B pathway.Collectively,these data suggest that ketogenic diet may have a therapeutic potential in treating Alzheimer's disease by ameliorating the neurotoxicity associated with Aβ-induced inflammation.This study highlights the urgent need for further research into the use of ketogenic diet as a potential therapy for Alzheimer's disease.展开更多
Biomarke rs are required for the early detection,prognosis prediction,and monitoring of amyotrophic lateral sclerosis,a progressive disease.Proteomics is an unbiased and quantitative method that can be used to detect ...Biomarke rs are required for the early detection,prognosis prediction,and monitoring of amyotrophic lateral sclerosis,a progressive disease.Proteomics is an unbiased and quantitative method that can be used to detect neurochemical signatures to aid in the identification of candidate biomarke rs.In this study,we used a label-free quantitative proteomics approach to screen for substantially differentially regulated proteins in ten patients with sporadic amyotrophic lateral scle rosis compared with five healthy controls.Su bstantial upregulation of serum proteins related to multiple functional clusters was observed in patients with spo radic amyotrophic lateral sclerosis.Potential biomarke rs were selected based on functionality and expression specificity.To validate the proteomics profiles,blood samples from an additional cohort comprising 100 patients with sporadic amyotrophic lateral sclerosis and 100 healthy controls were subjected to enzyme-linked immunosorbent assay.Eight substantially upregulated serum proteins in patients with spora dic amyotrophic lateral sclerosis were selected,of which the cathelicidin-related antimicrobial peptide demonstrated the best discriminative ability between patients with sporadic amyotrophic lateral sclerosis and healthy controls(area under the curve[AUC]=0.713,P<0.0001).To further enhance diagnostic accuracy,a multi-protein combined discriminant algorithm was developed incorporating five proteins(hemoglobin beta,cathelicidin-related antimicrobial peptide,talin-1,zyxin,and translationally-controlled tumor protein).The algo rithm achieved an AUC of 0.811 and a P-value of<0.0001,resulting in 79%sensitivity and 71%specificity for the diagnosis of sporadic amyotrophic lateral scle rosis.Subsequently,the ability of candidate biomarkers to discriminate between early-stage amyotrophic lateral sclerosis patients and controls,as well as patients with different disease severities,was examined.A two-protein panel comprising talin-1 and translationally-controlled tumor protein effectively distinguished early-stage amyotrophic lateral sclerosis patients from controls(AUC=0.766,P<0.0001).Moreove r,the expression of three proteins(FK506 binding protein 1A,cathelicidin-related antimicrobial peptide,and hemoglobin beta-1)was found to increase with disease progression.The proteomic signatures developed in this study may help facilitate early diagnosis and monitor the progression of sporadic amyotrophic lateral sclerosis when used in co mbination with curre nt clinical-based parameters.展开更多
Background： Late-onset multiple acyl-CoA dehydrogenase deficiency （MADD） is the most common type of lipid storage myopathies in China. Most patients with late-onset MADD are well responsive to riboflavin. Up to now...Background： Late-onset multiple acyl-CoA dehydrogenase deficiency （MADD） is the most common type of lipid storage myopathies in China. Most patients with late-onset MADD are well responsive to riboflavin. Up to now, these patients are often treated with glucocorticoids as the first-line drug because they are misdiagnosed as polymyositis without muscle biopsy or gene analysis. Although glucocorticoids seem to improve the fatty acid metabolism of late-onset MADD, the objective evaluation of their rationalization on this disorder and comparison with riboflavin treatment are unknown. Methods： We performed a historical cohort study on the efficacy of the two drugs among 45 patients with late-onset MADD, who were divided into glucocorticoids group and riboflavin group. Detailed clinical information of baseline and 1-month follow-up were collected. Results： After 1-month treatment, a dramatic improvement of muscle strength was found in riboflavin group （P 〈 0.05）. There was no significant difference in muscle enzymes between the two groups. Significantly, the number of patients with full recovery in glucocorticoids group was less than the number in riboflavin group （P 〈 0.05）. On the other hand, almost half of the patients in riboflavin group still presented high-level muscle enzymes and weak muscle strength after 1-month riboflavin treatment, meaning that l-month treatment duration maybe insufficient and patients should keep on riboflavin supplement for a longer time. Conclusions： Our results provide credible evidences that the overall efficacy of riboflavin is superior to glucocorticoids, and a longer duration of riboflavin treatment is necessary for patients with late-onset MADD.展开更多
Alzheimer’s disease(AD)is a neurodegenerative disorder that impairs mainly the memory and cognitive function in elderly.Extracellular beta amyloid deposition and intracellular tau hyperphosphorylation are the two pat...Alzheimer’s disease(AD)is a neurodegenerative disorder that impairs mainly the memory and cognitive function in elderly.Extracellular beta amyloid deposition and intracellular tau hyperphosphorylation are the two pathological events that are thought to cause neuronal dysfunction in AD.Since the detailed mechanisms that underlie the pathogenesis of AD are still not clear,the current treatments are those drugs that can alleviate the symptoms of AD patients.Recent studies have indicated that these symptom-reliving drugs also have the ability of regulating amyloid precursor protein processing and tau phosphorylation.Thus the pharmacological mechanism of these drugs may be too simply-evaluated.This review summarizes the current status of AD therapy and some potential preclinical considerations that target beta amyloid and tau protein are also discussed.展开更多
Background：Paroxysmal kinesigenic dyskinesia （PKD） is a rare movement disorder characterized by recurrent dystonic or choreoathetoid attacks triggered by sudden voluntary movements.Under the condition of psychologi...Background：Paroxysmal kinesigenic dyskinesia （PKD） is a rare movement disorder characterized by recurrent dystonic or choreoathetoid attacks triggered by sudden voluntary movements.Under the condition of psychological burden,some patients＆#39; attacks may get worsened with longer duration and higher frequency.This study aimed to assess nonmotor symptoms and quality of life of patients with PKD in a large population.Methods：We performed a cross-sectional survey in 165 primary PKD patients from August 2008 to October 2016 in Rui Jin Hospital,using Symptom Check List-90-Revised （SCL-90-R）,World Health Organization Quality of Life-100 （WHOQoL-100）,Self-Rating Depression Scale,and Self-Rating Anxiety Scale.We evaluated the differences of SCL-90-R and WHOQOL-100 scores in patients and Chinese normative data （taken from literature） by using the unpaired Student＆#39;s t-test.We applied multivariate linear regression to analyze the relationships between motor manifestations,mental health,and quality of life among PKD patients.Results：Compared with Chinese normative data taken from literature,patients with PKD exhibited significantly higher （worse） scores across all SCL-90-R subscales （somatization,obsessive-compulsive,interpersonal sensitivity,depression,anxiety,hostility,phobic anxiety,paranoid ideation,and psychoticism;P =0.000 for all） and significantly lower （worse） scores of five domains in WHOQoL-100 （physical domain,psychological domain,independence domain,social relationship domain,and general quality of life;P =0.000 for all）.Nonremission of dyskinesia episodes （P =0.011） and higher depression score （P =0.000） were significantly associated with lower levels of quality of life.The rates of depression and anxiety in patients with PKD were 41.2% （68/165） and 26.7% （44/165）,respectively.Conclusions：Depression,anxiety,and low levels of quality of life were prevalent in patients with PKD.Co-occurrence of depression and anxiety was common among these patients.Regular mental health interventions could set depression and anxiety as intervention targets.Considering that the motor episodes could be elicited by voluntary movements and sometimes also by emotional stress,and that symptoms may get worsened with longer duration and higher frequency when patients are stressed out,intervention or treatment of depression and anxiety might improve the motor symptoms and overall quality of life in PKD patients.展开更多
Background： Paroxysmal kinesigenic dyskinesia （PKD） is the most common subtype of paroxysmal dyskinesias and is caused by mutations in PRRT2 gene. The majority of familial PKD was identified to harbor PRRT2 mutatio...Background： Paroxysmal kinesigenic dyskinesia （PKD） is the most common subtype of paroxysmal dyskinesias and is caused by mutations in PRRT2 gene. The majority of familial PKD was identified to harbor PRRT2 mutations. However, over two-third of sporadic PKD patients did not carry anyPRRT2 mutation, suggesting an existence of additional genetic mutations or possible misdiagnosis due to clinical overlap. Methods： A cohort of 28 Chinese patients clinically diagnosed with sporadic PKD and excluded PRRT2 mutations were recruited, Clinical features were evaluated, and all subjects were screened for MR-l, SLC2A1, and CLCN1 genes, which are the causative genes of paroxysmal nonkinesigenic dyskinesia （PNKD）, paroxysmal exertion-induced dyskinesia, and myotonia congenita （MC）, respectively, In addition, 200 genetically matched healthy individuals were recruited as controls. Results： A total of 16 genetic variants including 4 in MR-1 gene, 8 in SLC2A1 gene, and 4 in CLCN1 gene were detected. Among them, SLC2A1 c.363G〉A mutation was detected in one case, and CLCN1 c. 1205C〉T mutation was detected in other two cases. Neither of them was found in 200 controls as well as 1000 Genomes database and ExAC database. Both mutations were predicted to be pathogenic by SIFT and PolyPhen2. The SLC2A 1 c.363G〉A mutation was novel. Conclusions： The phenotypic overlap may lead to the difficulty in distinguishing PKD from PNKD and MC. For those PRRT2-negative PKD cases, screening of SLC2A1 and CLCN1 genes are useful in confirming the diagnosis.展开更多
Paroxysmal kinesigenic dyskinesia（PKD） and myotonia congenita（MC） are independent disorders that share some clinical features. We aimed to investigate the sequences of PRRT2 and CLCN1 in a proband diagnosed with P...Paroxysmal kinesigenic dyskinesia（PKD） and myotonia congenita（MC） are independent disorders that share some clinical features. We aimed to investigate the sequences of PRRT2 and CLCN1 in a proband diagnosed with PKD and suspected MC. Clinical evaluation and auxiliary examinations were performed. Direct sequencing of the entire coding regions of the PRRT2 and CLCN1 genes was conducted. Haplotype analysis confirmed the relationships among the family members. The proband suffered choreoathetosis attacks triggered by sudden movements, and lower-limb weakness a n d s t i ff n e s s t h a t w o r s e n e d i n c o l d w e a t h e r. Carbamazepine monotherapy completely controlled his choreoathetosis and significantly relieved his limb weakness and stiffness. His father, when young, had similar limb stiffness, while his mother and brother were asymptomatic. Genetic analysis revealed that the proband and his father harbored a PRRT2 c.649 dup C mutation, and CLCN1 c.1723C〉T and c.2492A〉G mutations. His brother carried only the two CLCN1 mutations. None of these mutations were identified in his mother and 150 unrelated controls. This is the first report showing the coexistence ofPRRT2 and CLCN1 mutations. Our results also indicate that both the PRRT2 and CLCN1 genes need to be screened if we fail to identify PRRT2 mutations in PKD patients or CLCN1 mutations in MC patients.展开更多
CRISPR-mediated genome editing is a revolutionary technology for genome manipulation that uses the CRISPR-Cas systems and base editors.Currently,poor efficiency and off-target problems have impeded the application of ...CRISPR-mediated genome editing is a revolutionary technology for genome manipulation that uses the CRISPR-Cas systems and base editors.Currently,poor efficiency and off-target problems have impeded the application of CRISPR systems.The on-target efficiency has been improved in several advanced versions of CRISPR systems,whereas the off-target detection still remains a key challenge.Here,we outline the different versions of CRISPR systems and off-target detection strategies,discuss the merits and limitations of off-target detection methods,and provide potential implications for further gene editing research.展开更多
Alzheimer’s disease(AD)is an age-related neurodegenerative disorder,characterized clinically by insidious onset of memory and cognition impairment,emergence of psychiatric symptoms and behavioral disorder,and impairm...Alzheimer’s disease(AD)is an age-related neurodegenerative disorder,characterized clinically by insidious onset of memory and cognition impairment,emergence of psychiatric symptoms and behavioral disorder,and impairment of activities of daily living(ADL).Traditional Chinese medicine(TCM)is practiced in the Chinese health care system for more than 2,000 years.In recent years,scientists have isolated many novel compounds from herbs,some of which improve dementia with fewer side effects than conventional drugs and are regarded as potential anti-AD drugs.In this review,we summarize the latest research progress on TCM showing their possible role of treatment of AD and other demented diseases and possible pharmacological actions.展开更多
To the Editor:Late-onset multiple acyl-CoA dehydrogenase deficiency(MADD)is clinically characterized by a fluctuating or progressive proximal myopathy,exercise intolerance but good responsive to riboflavin.ETFDH mutat...To the Editor:Late-onset multiple acyl-CoA dehydrogenase deficiency(MADD)is clinically characterized by a fluctuating or progressive proximal myopathy,exercise intolerance but good responsive to riboflavin.ETFDH mutations are a major cause of late-onset MADD.We analyzed the clinical course,biochemical studies,and muscle magnetic resonance imaging(MRI)and pathologies of two late-onset MADD adult male patients who were misdiagnosed as polymyositis and presented with serious clinical symptoms of rhabdomyolysis and respiratory insufficient after using large dosage of intravenous glucocorticoids.Our current report broadens the clinical phenotypes spectrum of MADD and reminds clinicians to be cautious about using large dosage glucocorticoids in metabolic compromised patients.展开更多
Background： Mitochondrial dysflmction is linked to the pathogenesis of Parkinson＇s disease （PD）. However, the precise role of mitochondrial DNA （mtDNA） variations is obscure. On the other hand, mtDNA haplogroups...Background： Mitochondrial dysflmction is linked to the pathogenesis of Parkinson＇s disease （PD）. However, the precise role of mitochondrial DNA （mtDNA） variations is obscure. On the other hand, mtDNA haplogroups have been inconsistently reported to modify the risk of PD among differeni population. Here, we try to explore the relationship between mtDNA haplogroups and sporadic PD in a Han Chinese population. Methods： Nine single-nucleotide polymorphisms, which define the major Asian mtDNA haplogroups （A, B, C, D, F, G）, were detected via polymerase chain reaction-restriction fragment length polymorphism or denaturing polyacrylamide gel electrophoresis in 279 sporadic PD patients and 510 matched controls of Hart population. Results： Overall, the distribution ofmtDNA haplogroups did not show any significant differences between patients and controls. However, alter stratification by age at onset, the frequency of haplogroup B was significantly lower in patients with early-onset PD （EOPD） compared to the controls （odds ratio [OR] =0.225, 95% confidence interval [CI]： 0.082-0.619, P 0.004）, while other haplogroups did not show significant differences. Alter stratification by age at examination, among subjects younger than 50 years of age： Haplogroup B also showed a lower frequency in PD cases （OR = 0. 146, 95% CI： 0.030-0.715~ P = 0.018） while haplogroup D presented a higher risk of PD （OR - 3.579, 95% CI： 1. 112-11.523, P = 0.033）, other haplogroups also did not show significant differences in the group. Conclusions： Our study indicates that haplogroup B might confer a lower risk for EOPD and people younger than 50 years in Han Chinese, while haplogroup D probably lead a higher risk of PD in people younger than 50 years of age. In brief particular Asian mtDNA haplogroups likely play a role in the pathogenesis of PD among Hart Chinese.展开更多
Wilson disease is an autosomal recessive disorder of copper metabolism.Diagnosis depends primarily on clinical features,biochemical parameters and the presence of the Kayser-Fleischer ring.Genetic analysis for mutatio...Wilson disease is an autosomal recessive disorder of copper metabolism.Diagnosis depends primarily on clinical features,biochemical parameters and the presence of the Kayser-Fleischer ring.Genetic analysis for mutations within ATP7B is a convincing diagnostic tool.The traditional treatment for WD includes chelation of excessive copper accumulation and reduction of copper intake.Medical therapy is effective but WD is not yet curable.Liver transplantation is especially helpful for patients who fail to respond to medical therapy or present with fulminant liver failure,although evaluation of its long-term effect are still in need.展开更多
To the Editor:Parkinson’s disease(PD)is one of the most common neurodegenerative movement disorders.[1]The severity of PD-related motor symptoms is usually semiquantitatively(“normal”,“slight”,“mild”,“moderate...To the Editor:Parkinson’s disease(PD)is one of the most common neurodegenerative movement disorders.[1]The severity of PD-related motor symptoms is usually semiquantitatively(“normal”,“slight”,“mild”,“moderate”,and“severe”)evaluated by expert physicians according to the Movement Disorder Society-sponsored revision of the Unified Parkinson’s Disease Rating Scale Part III(MDS-UPDRS III).[2]However,the MDS-UPDRS III is semiquantitative and subjective,which might mask mild treatment effects or even provide false-positive results.展开更多
Huntington's disease(HD) is a deadly neurodegenerative disease with abnormal expansion of CAG repeats in the huntingtin gene. Mutant Huntingtin protein(m HTT) forms abnormal aggregates and intranuclear inclusions ...Huntington's disease(HD) is a deadly neurodegenerative disease with abnormal expansion of CAG repeats in the huntingtin gene. Mutant Huntingtin protein(m HTT) forms abnormal aggregates and intranuclear inclusions in specific neurons, resulting in cell death. Here,we tested the ability of a natural heat-shock protein 90 inhibitor, Gedunin, to degrade transfected m HTT in Neuro-2 a cells and endogenous m HTT aggregates and intranuclear inclusions in both fibroblasts from HD patients and neurons derived from induced pluripotent stem cells from patients. Our data showed that Gedunin treatment degraded transfected m HTT in Neuro-2 a cells, endogenous m HTT aggregates and intranuclear inclusions in fibroblasts from HD patients, and in neurons derived from induced pluripotent stem cells from patients in a dose-and time-dependent manner, and its activity depended on the proteasomal pathway rather than the autophagy route. These findings also showed that although Gedunin degraded abnormal m HTT aggregates and intranuclear inclusions in cells from HD patient, it did not affect normal cells, thus providing a new perspective for using Gedunin to treat HD.展开更多
Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as micr...Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.展开更多
Background Although there were criteria for diagnosis of neuromyelitis optica （NMO） and multiple sclerosis （MS）,it is still difficult to differentiate NMO from MS,due to the overlapping clinical manifestations.The...Background Although there were criteria for diagnosis of neuromyelitis optica （NMO） and multiple sclerosis （MS）,it is still difficult to differentiate NMO from MS,due to the overlapping clinical manifestations.Therefore it is necessary to characterize clinical features of NMO and MS patients in the mainland of China,to simplify the process of disease diagnosis,and to identify criteria for the differential diagnosis of NMO and MS.Methods A total of 138 Chinese Han patients from the mainland of China including 73 NMO,60 MS and 5 MS-like patients with positive NMO-IgG were included in the study.Clinical records were reviewed retrospectively and the results of clinical examination,laboratory experiments,magnetic resonance imaging （MRI） and evoked potentials （EPs） were compared between NMO and MS patients.In addition,the relationship between the NMO-IgG serologic status and clinical characteristics were analyzed.Results Compared with MS patients （1.3∶ 1.0）,more female prevalence was observed in NMO patients （4.2∶ 1.0; P=0.003）.There were also statistically significant differences in visual EPs,oligoclonal bands,brainstem lesions in MRI and longitudinally extensive spinal cord lesions （LESCLs） between NMO and MS patients.Brainstem lesions observed in brain MRI were found in 17.9% of MS patients,over 3.7 times higher than in NMO patients （4.8%,P=0.024）.When stratified NMO patients by NMO-IgG,LESCLs were found in 42.1% of NMO-IgG-negative NMO patients,over 3.5 times higher than in NMO-IgG-positive patients （11.9%,P=0.008）.Statistical difference was also observed in CD4＋/CD8＋ ratios between NMO-IgG-positive and-negative NMO patients.Conclusions Comprehensive analysis of MRI,laboratory and EPs data can facilitate differential diagnosis of MS and NMO.In addition,the combination of LESCLs and brain MRI findings failing to satisfy MRI criteria for MS is highly sensitive and specific for NMO.展开更多
基金supported by the Ministry of Science and Technology of the People's Republic of China(2021ZD0201804,GW)National Natural Science Foundation of China(92068111,81973272,XG,81903582,QS)+1 种基金Natural Science Foundation of Shanghai(219ZR1431500,GW)Shanghai Science and Technology Committee(121XD1422200,XG)and Cellular Biomedicine Group(CBMG,Shanghai,China).
文摘Background There have been no effective treatments for slowing or reversing Alzheimer’s disease(AD)until now.Growing preclinical evidence,including this study,suggests that mesenchymal stem cells-secreted exosomes(MSCs-Exos)have the potential to cure AD.Aims The first three-arm,drug-intervention,phase I/II clinical trial was conducted to explore the safety and efficacy of allogenic human adipose MSCs-Exos(ahaMSCs-Exos)in patients with mild to moderate AD.Methods The eligible subjects were assigned to one of three dosage groups,intranasally administrated with ahaMSCs-Exos two times per week for 12 weeks,and underwent follow-up visits at weeks 16,24,36 and 48.Results No adverse events were reported.In the medium-dose arm,Alzheimer’s Disease Assessment Scale–Cognitive section(ADAS-cog)scores decreased by 2.33(1.19)and the basic version of Montreal Cognitive Assessment scores increased by 2.38(0.58)at week 12 compared with baseline levels,indicating improved cognitive function.Moreover,the ADAS-cog scores in the medium-dose arm decreased continuously by 3.98 points until week 36.There were no significant differences in altered amyloid or tau deposition among the three arms,but hippocampal volume shrank less in the medium-dose arm to some extent.Conclusions Intranasal administration of ahaMSCs-Exos was safe and well tolerated,and a dose of at least 4×10^(8)particles could be selected for further clinical trials.
文摘Parkinson’s disease (PD) is one of the commonest neurodegenerative disorders characterized by the loss of dopaminergic (DAergic) neurons in the substantia nigra and the appearance of Lewy bodies (LBs), whose cytoplasmic inclusions are highly enriched with ubiquitin, synphilin-1, α-synuclein and parkin. Synphilin-1 is an α-synuclein-binding protein and a major component of LBs. It is widely accepted that synphilin-1 is involved in the pathogenic process of PD. This review will provide an overall view of the role of synphilin-1 in the pathogenesis of Parkinson’s disease and the latest findings in this field.
文摘Parkinson’s disease (PD) is a slowly progressive neurodegenerative disorder characterized clinically by bradykinesia, rigidity, tremor, gait dysfunction, and postural instability. Several genes have been identified for monogenic disorders that variably resemble Parkinson’s disease. Here, we focus on PARK7, a gene relates to an autosomal recessive form of early-onset Parkinsonism and encodes a protein named DJ-1. Though the exact role of DJ-1 needs to be elucidated, it is generally thought to be functioned as a molecular chaperone and an oxidative sensor (or antioxidative factor). We will review the protective role of DJ-1 to prevent dopaminergic neurons in the substantia nigra pars compacta (SNpc) from degeneration and how its dysfunction would lead to neurodegeneration.
基金the National Natural Science Foundation of China(No.82271412 to J.H.,82025012 to W.J.C.,U1905210 to W.J.C.).
文摘Adult polyglucosan body disease(APBD)is a rare and highly heterogeneous glycogen storage disorder due to biallelic variants in GBE1.1 Typical APBD presentations include gait abnormalities with polyneuropathy,leukodystrophy,neurogenic bladder,and mild cognitive impairment.Differential diagnosis of APBD encompasses a large spectrum of conditions including axonal and demyelinating sensorimotor polyneuropathy,progressive spastic paraparesis,and leukodystrophies.
基金the National Natural Science Foundation of China,Nos.82171401,81971187(to SC)and 81971183(to YT)grants from Shanghai Municipal Science and Technology Major Project,No.2018SHZDZX05(to SC)Shanghai Municipal Education Commission,No.2017-01-07-00-01-E00046(to SC)。
文摘Alzheimer's disease is a progressive neurological disorder characterized by cognitive decline and chronic inflammation within the brain.The ketogenic diet,a widely recognized therapeutic intervention for refractory epilepsy,has recently been proposed as a potential treatment for a variety of neurological diseases,including Alzheimer's disease.However,the efficacy of ketogenic diet in treating Alzheimer's disease and the underlying mechanism remains unclear.The current investigation aimed to explore the effect of ketogenic diet on cognitive function and the underlying biological mechanisms in a mouse model of Alzheimer's disease.Male amyloid precursor protein/presenilin 1(APP/PS1)mice were randomly assigned to either a ketogenic diet or control diet group,and received their respective diets for a duration of 3 months.The findings show that ketogenic diet administration enhanced cognitive function,attenuated amyloid plaque formation and proinflammatory cytokine levels in APP/PS1 mice,and augmented the nuclear factor-erythroid 2-p45 derived factor 2/heme oxygenase-1 signaling pathway while suppressing the nuclear factor-kappa B pathway.Collectively,these data suggest that ketogenic diet may have a therapeutic potential in treating Alzheimer's disease by ameliorating the neurotoxicity associated with Aβ-induced inflammation.This study highlights the urgent need for further research into the use of ketogenic diet as a potential therapy for Alzheimer's disease.
基金supported by the grants from Shanghai Shuguang Plan Project,No.18SG15(to SC)Shanghai Outstanding Young Scholars Project+2 种基金Shanghai Talent Development Project,No.2019044(to SC)Medical-engineering cross fund of Shanghai Jiao Tong University,No.YG2022QN009(to QZ)the National Natural Science Foundation of China,No.82201558(to QZ)。
文摘Biomarke rs are required for the early detection,prognosis prediction,and monitoring of amyotrophic lateral sclerosis,a progressive disease.Proteomics is an unbiased and quantitative method that can be used to detect neurochemical signatures to aid in the identification of candidate biomarke rs.In this study,we used a label-free quantitative proteomics approach to screen for substantially differentially regulated proteins in ten patients with sporadic amyotrophic lateral scle rosis compared with five healthy controls.Su bstantial upregulation of serum proteins related to multiple functional clusters was observed in patients with spo radic amyotrophic lateral sclerosis.Potential biomarke rs were selected based on functionality and expression specificity.To validate the proteomics profiles,blood samples from an additional cohort comprising 100 patients with sporadic amyotrophic lateral sclerosis and 100 healthy controls were subjected to enzyme-linked immunosorbent assay.Eight substantially upregulated serum proteins in patients with spora dic amyotrophic lateral sclerosis were selected,of which the cathelicidin-related antimicrobial peptide demonstrated the best discriminative ability between patients with sporadic amyotrophic lateral sclerosis and healthy controls(area under the curve[AUC]=0.713,P<0.0001).To further enhance diagnostic accuracy,a multi-protein combined discriminant algorithm was developed incorporating five proteins(hemoglobin beta,cathelicidin-related antimicrobial peptide,talin-1,zyxin,and translationally-controlled tumor protein).The algo rithm achieved an AUC of 0.811 and a P-value of<0.0001,resulting in 79%sensitivity and 71%specificity for the diagnosis of sporadic amyotrophic lateral scle rosis.Subsequently,the ability of candidate biomarkers to discriminate between early-stage amyotrophic lateral sclerosis patients and controls,as well as patients with different disease severities,was examined.A two-protein panel comprising talin-1 and translationally-controlled tumor protein effectively distinguished early-stage amyotrophic lateral sclerosis patients from controls(AUC=0.766,P<0.0001).Moreove r,the expression of three proteins(FK506 binding protein 1A,cathelicidin-related antimicrobial peptide,and hemoglobin beta-1)was found to increase with disease progression.The proteomic signatures developed in this study may help facilitate early diagnosis and monitor the progression of sporadic amyotrophic lateral sclerosis when used in co mbination with curre nt clinical-based parameters.
基金grants from the National Natural Science Foundation of China，National Key Clinical Specialty Discipline Construction Program,and Fujian Key Clinical Specialty Discipline Construction Program
文摘Background： Late-onset multiple acyl-CoA dehydrogenase deficiency （MADD） is the most common type of lipid storage myopathies in China. Most patients with late-onset MADD are well responsive to riboflavin. Up to now, these patients are often treated with glucocorticoids as the first-line drug because they are misdiagnosed as polymyositis without muscle biopsy or gene analysis. Although glucocorticoids seem to improve the fatty acid metabolism of late-onset MADD, the objective evaluation of their rationalization on this disorder and comparison with riboflavin treatment are unknown. Methods： We performed a historical cohort study on the efficacy of the two drugs among 45 patients with late-onset MADD, who were divided into glucocorticoids group and riboflavin group. Detailed clinical information of baseline and 1-month follow-up were collected. Results： After 1-month treatment, a dramatic improvement of muscle strength was found in riboflavin group （P 〈 0.05）. There was no significant difference in muscle enzymes between the two groups. Significantly, the number of patients with full recovery in glucocorticoids group was less than the number in riboflavin group （P 〈 0.05）. On the other hand, almost half of the patients in riboflavin group still presented high-level muscle enzymes and weak muscle strength after 1-month riboflavin treatment, meaning that l-month treatment duration maybe insufficient and patients should keep on riboflavin supplement for a longer time. Conclusions： Our results provide credible evidences that the overall efficacy of riboflavin is superior to glucocorticoids, and a longer duration of riboflavin treatment is necessary for patients with late-onset MADD.
基金This study was supported by grants from the State Key Basic Research Program(No.2010CB945200)National"Twelfth Five-Year"Plan for Science&Technology Support(2012BAI10B03)+2 种基金Program for Outstanding Medical Academic Leader(No.LJ 06003)Shanghai Jiao Tong University Medical and Engineering Joint Key Project(No.YG2010ZD102)Henan Key Science and Technology Project(No.112102310684).
文摘Alzheimer’s disease(AD)is a neurodegenerative disorder that impairs mainly the memory and cognitive function in elderly.Extracellular beta amyloid deposition and intracellular tau hyperphosphorylation are the two pathological events that are thought to cause neuronal dysfunction in AD.Since the detailed mechanisms that underlie the pathogenesis of AD are still not clear,the current treatments are those drugs that can alleviate the symptoms of AD patients.Recent studies have indicated that these symptom-reliving drugs also have the ability of regulating amyloid precursor protein processing and tau phosphorylation.Thus the pharmacological mechanism of these drugs may be too simply-evaluated.This review summarizes the current status of AD therapy and some potential preclinical considerations that target beta amyloid and tau protein are also discussed.
文摘Background：Paroxysmal kinesigenic dyskinesia （PKD） is a rare movement disorder characterized by recurrent dystonic or choreoathetoid attacks triggered by sudden voluntary movements.Under the condition of psychological burden,some patients＆#39; attacks may get worsened with longer duration and higher frequency.This study aimed to assess nonmotor symptoms and quality of life of patients with PKD in a large population.Methods：We performed a cross-sectional survey in 165 primary PKD patients from August 2008 to October 2016 in Rui Jin Hospital,using Symptom Check List-90-Revised （SCL-90-R）,World Health Organization Quality of Life-100 （WHOQoL-100）,Self-Rating Depression Scale,and Self-Rating Anxiety Scale.We evaluated the differences of SCL-90-R and WHOQOL-100 scores in patients and Chinese normative data （taken from literature） by using the unpaired Student＆#39;s t-test.We applied multivariate linear regression to analyze the relationships between motor manifestations,mental health,and quality of life among PKD patients.Results：Compared with Chinese normative data taken from literature,patients with PKD exhibited significantly higher （worse） scores across all SCL-90-R subscales （somatization,obsessive-compulsive,interpersonal sensitivity,depression,anxiety,hostility,phobic anxiety,paranoid ideation,and psychoticism;P =0.000 for all） and significantly lower （worse） scores of five domains in WHOQoL-100 （physical domain,psychological domain,independence domain,social relationship domain,and general quality of life;P =0.000 for all）.Nonremission of dyskinesia episodes （P =0.011） and higher depression score （P =0.000） were significantly associated with lower levels of quality of life.The rates of depression and anxiety in patients with PKD were 41.2% （68/165） and 26.7% （44/165）,respectively.Conclusions：Depression,anxiety,and low levels of quality of life were prevalent in patients with PKD.Co-occurrence of depression and anxiety was common among these patients.Regular mental health interventions could set depression and anxiety as intervention targets.Considering that the motor episodes could be elicited by voluntary movements and sometimes also by emotional stress,and that symptoms may get worsened with longer duration and higher frequency when patients are stressed out,intervention or treatment of depression and anxiety might improve the motor symptoms and overall quality of life in PKD patients.
基金Supplementary information is linked to the online version of the paper on the Chinese Medical Journal website.This work was supported by grants from the National Natural Science Foundation of China to Zhi-Ying Wu （No. 81330025 and No. 81125009）.
文摘Background： Paroxysmal kinesigenic dyskinesia （PKD） is the most common subtype of paroxysmal dyskinesias and is caused by mutations in PRRT2 gene. The majority of familial PKD was identified to harbor PRRT2 mutations. However, over two-third of sporadic PKD patients did not carry anyPRRT2 mutation, suggesting an existence of additional genetic mutations or possible misdiagnosis due to clinical overlap. Methods： A cohort of 28 Chinese patients clinically diagnosed with sporadic PKD and excluded PRRT2 mutations were recruited, Clinical features were evaluated, and all subjects were screened for MR-l, SLC2A1, and CLCN1 genes, which are the causative genes of paroxysmal nonkinesigenic dyskinesia （PNKD）, paroxysmal exertion-induced dyskinesia, and myotonia congenita （MC）, respectively, In addition, 200 genetically matched healthy individuals were recruited as controls. Results： A total of 16 genetic variants including 4 in MR-1 gene, 8 in SLC2A1 gene, and 4 in CLCN1 gene were detected. Among them, SLC2A1 c.363G〉A mutation was detected in one case, and CLCN1 c. 1205C〉T mutation was detected in other two cases. Neither of them was found in 200 controls as well as 1000 Genomes database and ExAC database. Both mutations were predicted to be pathogenic by SIFT and PolyPhen2. The SLC2A 1 c.363G〉A mutation was novel. Conclusions： The phenotypic overlap may lead to the difficulty in distinguishing PKD from PNKD and MC. For those PRRT2-negative PKD cases, screening of SLC2A1 and CLCN1 genes are useful in confirming the diagnosis.
基金supported by grants from the National Natural Science Foundation of China (81330025 and 81125009)
文摘Paroxysmal kinesigenic dyskinesia（PKD） and myotonia congenita（MC） are independent disorders that share some clinical features. We aimed to investigate the sequences of PRRT2 and CLCN1 in a proband diagnosed with PKD and suspected MC. Clinical evaluation and auxiliary examinations were performed. Direct sequencing of the entire coding regions of the PRRT2 and CLCN1 genes was conducted. Haplotype analysis confirmed the relationships among the family members. The proband suffered choreoathetosis attacks triggered by sudden movements, and lower-limb weakness a n d s t i ff n e s s t h a t w o r s e n e d i n c o l d w e a t h e r. Carbamazepine monotherapy completely controlled his choreoathetosis and significantly relieved his limb weakness and stiffness. His father, when young, had similar limb stiffness, while his mother and brother were asymptomatic. Genetic analysis revealed that the proband and his father harbored a PRRT2 c.649 dup C mutation, and CLCN1 c.1723C〉T and c.2492A〉G mutations. His brother carried only the two CLCN1 mutations. None of these mutations were identified in his mother and 150 unrelated controls. This is the first report showing the coexistence ofPRRT2 and CLCN1 mutations. Our results also indicate that both the PRRT2 and CLCN1 genes need to be screened if we fail to identify PRRT2 mutations in PKD patients or CLCN1 mutations in MC patients.
基金supported by the grants 81771230(W.C.),31922048(E.Z.)and 31522037(H.Y.)from the National Natural Science Foundation of China.
文摘CRISPR-mediated genome editing is a revolutionary technology for genome manipulation that uses the CRISPR-Cas systems and base editors.Currently,poor efficiency and off-target problems have impeded the application of CRISPR systems.The on-target efficiency has been improved in several advanced versions of CRISPR systems,whereas the off-target detection still remains a key challenge.Here,we outline the different versions of CRISPR systems and off-target detection strategies,discuss the merits and limitations of off-target detection methods,and provide potential implications for further gene editing research.
基金This study was supported by grants from the State Key Basic Research Program(No.2010CB945200)National“Twelfth Five-Year”Plan for Science&Technology Support(2012BAI10B03)+1 种基金Program for Outstanding Medical Academic Leader(No.LJ 06003)Henan Key Science and Technology Project(No.112102310684).
文摘Alzheimer’s disease(AD)is an age-related neurodegenerative disorder,characterized clinically by insidious onset of memory and cognition impairment,emergence of psychiatric symptoms and behavioral disorder,and impairment of activities of daily living(ADL).Traditional Chinese medicine(TCM)is practiced in the Chinese health care system for more than 2,000 years.In recent years,scientists have isolated many novel compounds from herbs,some of which improve dementia with fewer side effects than conventional drugs and are regarded as potential anti-AD drugs.In this review,we summarize the latest research progress on TCM showing their possible role of treatment of AD and other demented diseases and possible pharmacological actions.
基金grants from National Natural Science Foundation of China(U1505222,81271254,Beijing).
文摘To the Editor:Late-onset multiple acyl-CoA dehydrogenase deficiency(MADD)is clinically characterized by a fluctuating or progressive proximal myopathy,exercise intolerance but good responsive to riboflavin.ETFDH mutations are a major cause of late-onset MADD.We analyzed the clinical course,biochemical studies,and muscle magnetic resonance imaging(MRI)and pathologies of two late-onset MADD adult male patients who were misdiagnosed as polymyositis and presented with serious clinical symptoms of rhabdomyolysis and respiratory insufficient after using large dosage of intravenous glucocorticoids.Our current report broadens the clinical phenotypes spectrum of MADD and reminds clinicians to be cautious about using large dosage glucocorticoids in metabolic compromised patients.
基金This work was supported by the grant 81322017 from the National Natural Science Foundation of China, grant NCET-13-0736 from Program for New Century Excellent Talents in University, National Key Clinical Specialty Discipline Construction Program and Key Clinical Specialty Discipline Construction Program of Fujian.
文摘Background： Mitochondrial dysflmction is linked to the pathogenesis of Parkinson＇s disease （PD）. However, the precise role of mitochondrial DNA （mtDNA） variations is obscure. On the other hand, mtDNA haplogroups have been inconsistently reported to modify the risk of PD among differeni population. Here, we try to explore the relationship between mtDNA haplogroups and sporadic PD in a Han Chinese population. Methods： Nine single-nucleotide polymorphisms, which define the major Asian mtDNA haplogroups （A, B, C, D, F, G）, were detected via polymerase chain reaction-restriction fragment length polymorphism or denaturing polyacrylamide gel electrophoresis in 279 sporadic PD patients and 510 matched controls of Hart population. Results： Overall, the distribution ofmtDNA haplogroups did not show any significant differences between patients and controls. However, alter stratification by age at onset, the frequency of haplogroup B was significantly lower in patients with early-onset PD （EOPD） compared to the controls （odds ratio [OR] =0.225, 95% confidence interval [CI]： 0.082-0.619, P 0.004）, while other haplogroups did not show significant differences. Alter stratification by age at examination, among subjects younger than 50 years of age： Haplogroup B also showed a lower frequency in PD cases （OR = 0. 146, 95% CI： 0.030-0.715~ P = 0.018） while haplogroup D presented a higher risk of PD （OR - 3.579, 95% CI： 1. 112-11.523, P = 0.033）, other haplogroups also did not show significant differences in the group. Conclusions： Our study indicates that haplogroup B might confer a lower risk for EOPD and people younger than 50 years in Han Chinese, while haplogroup D probably lead a higher risk of PD in people younger than 50 years of age. In brief particular Asian mtDNA haplogroups likely play a role in the pathogenesis of PD among Hart Chinese.
文摘Wilson disease is an autosomal recessive disorder of copper metabolism.Diagnosis depends primarily on clinical features,biochemical parameters and the presence of the Kayser-Fleischer ring.Genetic analysis for mutations within ATP7B is a convincing diagnostic tool.The traditional treatment for WD includes chelation of excessive copper accumulation and reduction of copper intake.Medical therapy is effective but WD is not yet curable.Liver transplantation is especially helpful for patients who fail to respond to medical therapy or present with fulminant liver failure,although evaluation of its long-term effect are still in need.
文摘To the Editor:Parkinson’s disease(PD)is one of the most common neurodegenerative movement disorders.[1]The severity of PD-related motor symptoms is usually semiquantitatively(“normal”,“slight”,“mild”,“moderate”,and“severe”)evaluated by expert physicians according to the Movement Disorder Society-sponsored revision of the Unified Parkinson’s Disease Rating Scale Part III(MDS-UPDRS III).[2]However,the MDS-UPDRS III is semiquantitative and subjective,which might mask mild treatment effects or even provide false-positive results.
基金supported by the National Key Research and Development Program of China (2018YFA0108004)the National Natural Science Foundation of China (81271259)
文摘Huntington's disease(HD) is a deadly neurodegenerative disease with abnormal expansion of CAG repeats in the huntingtin gene. Mutant Huntingtin protein(m HTT) forms abnormal aggregates and intranuclear inclusions in specific neurons, resulting in cell death. Here,we tested the ability of a natural heat-shock protein 90 inhibitor, Gedunin, to degrade transfected m HTT in Neuro-2 a cells and endogenous m HTT aggregates and intranuclear inclusions in both fibroblasts from HD patients and neurons derived from induced pluripotent stem cells from patients. Our data showed that Gedunin treatment degraded transfected m HTT in Neuro-2 a cells, endogenous m HTT aggregates and intranuclear inclusions in fibroblasts from HD patients, and in neurons derived from induced pluripotent stem cells from patients in a dose-and time-dependent manner, and its activity depended on the proteasomal pathway rather than the autophagy route. These findings also showed that although Gedunin degraded abnormal m HTT aggregates and intranuclear inclusions in cells from HD patient, it did not affect normal cells, thus providing a new perspective for using Gedunin to treat HD.
文摘Background:Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality.Rapidity and accuracy of diagnosis contribute to better prognosis,but readily available tools,such as microscopy,culture,and antigens do not perform well all the time.Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid(CSF)samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer(ITS)amplicons.Methods:The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls.Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital,Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018.ITS1 ribosomal deoxyribonucleic acid(rDNA)genes of 15 whole samples were amplified by universal forward primer ITS1(CTTGGTCATTTAGAGGAAGTAA)and reverse primer ITS2(GCTGCGTTCTTCATCGATGC),sequenced by Illumina MiSeq Benchtop Sequencer.The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples.Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis(PERMANOVA)in R software.Results:The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control.The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance(from 95.90%to 99.97%),followed by many other fungal groups(each<1.41%).ITS genotype was defined in 11 CSF samples,corresponding to ITS type 1,and confirmed by Sanger sequencing.A statistically significant difference(r2=0.65869,P=0.0014)between infectious group and control group was observed.Conclusions:The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples,which may provide a better diagnostic approach of cryptococcal infection.
基金This work was supported by grants from National Natural Science Foundation of China （No. 81125009 and No. 30911120488）.
文摘Background Although there were criteria for diagnosis of neuromyelitis optica （NMO） and multiple sclerosis （MS）,it is still difficult to differentiate NMO from MS,due to the overlapping clinical manifestations.Therefore it is necessary to characterize clinical features of NMO and MS patients in the mainland of China,to simplify the process of disease diagnosis,and to identify criteria for the differential diagnosis of NMO and MS.Methods A total of 138 Chinese Han patients from the mainland of China including 73 NMO,60 MS and 5 MS-like patients with positive NMO-IgG were included in the study.Clinical records were reviewed retrospectively and the results of clinical examination,laboratory experiments,magnetic resonance imaging （MRI） and evoked potentials （EPs） were compared between NMO and MS patients.In addition,the relationship between the NMO-IgG serologic status and clinical characteristics were analyzed.Results Compared with MS patients （1.3∶ 1.0）,more female prevalence was observed in NMO patients （4.2∶ 1.0; P=0.003）.There were also statistically significant differences in visual EPs,oligoclonal bands,brainstem lesions in MRI and longitudinally extensive spinal cord lesions （LESCLs） between NMO and MS patients.Brainstem lesions observed in brain MRI were found in 17.9% of MS patients,over 3.7 times higher than in NMO patients （4.8%,P=0.024）.When stratified NMO patients by NMO-IgG,LESCLs were found in 42.1% of NMO-IgG-negative NMO patients,over 3.5 times higher than in NMO-IgG-positive patients （11.9%,P=0.008）.Statistical difference was also observed in CD4＋/CD8＋ ratios between NMO-IgG-positive and-negative NMO patients.Conclusions Comprehensive analysis of MRI,laboratory and EPs data can facilitate differential diagnosis of MS and NMO.In addition,the combination of LESCLs and brain MRI findings failing to satisfy MRI criteria for MS is highly sensitive and specific for NMO.
